enzymein a sentence
-
Alcohol takes longer to pass through a food-filled stomach, allowing a protective enzyme to break down the alcohol.
enzyme = substance that causes a chemical reaction
- The antibiotic targets an enzyme the microbes depend on to reproduce.
- The enzyme helps break down protein stains.
-
That's when Japanese chemists discovered an enzyme that could transform glucose into the much sweeter sugar molecule called fructose.
(source)
enzyme = any complex protein that is produced by cells and acts a chemical catalyst (causing a chemical reaction)
- The toxin does the deed insidiously, indirectly, by inhibiting an enzyme essential to glycoprotein metabolism.† (source)
- It'll cut the DNA, using what are called restriction enzymes.† (source)
- Just one enzyme misfiring, just one wrong protein activation, and you could have cancer.† (source)
- Complex flavors are being made through fermentation, enzyme reactions, fungal cultures, and tissue cultures.† (source)
- Hilton suggested using enzymes to dissolve the connected tissue and leave the cancer cells intact.† (source)
- Reports on enzyme exchange communication between termites.† (source)
- There are ways to tell with absolute certainty whether someone is having a heart attack, but those involve tests of particular enzymes that can take hours for results.† (source)
show 71 more with this conextual meaning
- It was routine to check liver enzymes two weeks after starting treatment so the drug could be discontinued if there was any sign of liver damage.† (source)
- Perhaps an enzyme imbalance.† (source)
- There is a purity within her, a careful enzymatic balance she does not wish to disturb.† (source)
- His blood work showed high cholesterol, sucky liver enzymes, and a lot of white blood cells, which meant he had an infection somewhere, plus his blood pressure was through the roof.† (source)
- "Fascinating," said the woman, "to think that it possesses some process or enzyme that can convert common metals into something extraordinary.† (source)
- I will have a positive attitude, take care of myself, I'll feed myself enzymes, and friendly bacteria.† (source)
- Disturbs the gastric enzymes and leads to ulcers, the occupational disease of the underground.† (source)
- His ability, for example, to switch from enzymes to Quality Lit.† (source)
-
Each enzyme was like a single worker in a kitchen, doing just one thing.
(source)
enzyme = a complex protein that is produced by cells and acts as a chemical catalyst (causing a chemical reaction)
- Chang had used those cells to discover enzymes and genes specific to liver cells.† (source)
- The new enzyme-based processes are responsible for extremely lifelike dairy flavors.† (source)
- I inserted a gene that makes a single faulty enzyme in protein metabolism.† (source)
- As you can see in line 1201, two enzymes will cut on either side of the damaged point.† (source)
- The computer will select a variety of enzymes that might do the job.† (source)
- Cells could keep the hundreds of separate reactions straight, using enzymes.† (source)
- Without enzymes, there could be no chemical reactions.† (source)
- Which means that it has no proteins as we know them, and no enzymes.† (source)
- Enzymes were essential to life on earth.† (source)
- We busted that serum enzyme problem wide open!'† (source)
- The problem I was telling you about having to do with serum enzymes?† (source)
- They recycle organic matter with powerful enzymes that can break down organic molecules into simple molecules and minerals.† (source)
- After weeks of trying different combinations of enzymes, Hilton came up with just the right combination for us.† (source)
- If a chromosome disappeared and production of a certain enzyme stopped, researchers knew the gene for that enzyme must be on the most recently vanished chromosome.† (source)
- By the early nineties, a scientist at Yale had used HeLa to discover that human cancer cells contain an enzyme called telomerase that rebuilds their telomeres.† (source)
- This amount of DNA probably contains instructions to make a single protein-say, a hormone or an enzyme.† (source)
- …Formation and Characteristics of Hybrid Cells," in Cell Fusion: The Dunham Lectures (1970); The Cells of the Body: A History of Somatic Cell Genetics; "Behaviour of Differentiated Nuclei in Heterokaryons of Animal Cells from Different Species," Nature 206 (1965); "The Reactivation of the Red Cell Nucleus," Journal of Cell Science 2 (1967); and H. Harris and P. R. Harris, "Synthesis of an Enzyme Determined by an Erythrocyte Nucleus in a Hybrid Cell," Journal of Cell Science 5 (1966).† (source)
- Whatever problems might arise in the DNA were essentially point-problems in the code, causing a specific problem in the phenotype: an enzyme that didn't switch on, or a protein that didn't fold.† (source)
- …of Human Diploid Cell Strains," Experimental Cell Research, 25 (1961); L. Hayflick, "The Limited in Vitro Lifetime of Human Diploid Cell Strains," Experimental Cell Research 37 (1965); G. B. Morin, "The Human Telomere Terminal Transferase Enzyme Is a Ribonucleoprotein That Synthesizes TTAGGG Repeats," Cell 59 (1989); C. B. Harley, A. B. Futcher, and C. W Greider, "Telomeres Shorten During Ageing of Human Fibroblasts," Nature 345 (May 31, 1990); C. W Greider and E. H. Blackburn,…† (source)
- It's crammed full of molecules and vessels endlessly shuttling enzymes and sugars from one part of the cell to another, pumping water, nutrients, and oxygen in and out of the cell.† (source)
- You couldn't really predict behavior, and you couldn't really control it, except in very crude ways, like making an animal dependent on a dietary substance by withholding an enzyme.† (source)
- Because this enzyme was a marker for genetic engineering, and not found in wild animals, technicians assumed it was a lab contaminant and did not report it when they called Dr, Cruz, the referring physician in Puntarenas.† (source)
- The other unusual thing scientists had noticed about cells growing in culture was that once they transformed and became cancerous, they all behaved alike—dividing identically and producing exactly the same proteins and enzymes, even though they'd all produced different ones before becoming malignant.† (source)
- A single microscopic bacterium, too small to see with the naked eye, but containing the genes for a heart-attack enzyme, streptokinase, or for "ice-minus," which prevented frost damage to crops, might be worth five billion dollars to the right buyer.† (source)
- After that, Hammond had agreed to study dilophosaur venom, which was found to contain seven different toxic enzymes.† (source)
- The dark bars you see arc restriction fragments-small sections of dinosaur DNA, broken by enzymes and then analyzed.† (source)
- …1021 GCGGTGCATGOAOCCOGOCCACCTCGACCTGAATOGAAGCCGOCGOCACCTCOCTAACOG 1081 CCAAGAATTGGAGCCAATCAATTCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGG 1141 CCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCT 1416 DnxTI SSpd4 1201 GCGCATGATCGTGCT:+=:CCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTTACT 1281 ATGAATCACCGATACGCGAGCGAACGTGAAGCGACTGCTGCTGCAAAACGTCTGCGACCT "Here is the same section of DNA, with the points of the restriction enzymes located.† (source)
- And it could do it many different ways: strep produced an enzyme, streptokinase, that dissolved coagulated plasma.† (source)
- He remembered that it operated like a kind of waterfall: one enzyme was set off, and activated, which acted on a second enzyme, which acted on a third; the third on a fourth; and so on, down through twelve or thirteen steps, until finally blood clotted.† (source)
- He recalled the remark of George Thompson, the British biochemist, who had called enzymes "the matchmakers of life."† (source)
- There were hundreds of thousands, perhaps millions, of enzymes, each existing solely to aid a single chemical reaction.† (source)
- It was almost impossible: on earth, proteins were part of the cell wall, and comprised all the enzymes known to man.† (source)
- His own research with staphylococcus, for example, had shown that this organism produced two enzymes that altered blood.† (source)
- On earth, organisms had evolved by learning to carry out biochemical reactions in a small space, with the help of protein enzymes.† (source)
- And vaguely he remembered the rest, the details: all the intermediate steps, the necessary enzymes, the metals, ions, local factors.† (source)
- It was true; enzymes acted as catalysts for all chemical reactions, by providing a surface for two molecules to come together and react upon.† (source)
- Enzymes, the matchmakers of life, helped chemical reactions to go forward at body temperature and atmospheric pressure.† (source)
- But enzymes had a further use.† (source)
-
…HEMOGLOBIN
INDICES MCV
DIAGNOSTICS
MCHC
PROTIME
CHOLEST
PTT
CREAT
SED RATE
GLUCOSE
PBI
CHEMISTRY
BEI i
BRO
I IBC
CA
NPN
CL
BUN
MG
BILIRU, DIFF
P04
CEPH/FLOC
K
THYMOL/TURB
NA C02
BSP
188 MICHAEL CRICHTON
ENZYMES
PULMONARY
AMYLASE
TVC
CHOLINESTERASE
TV
LIPASE
IC
PHOSPHATASE, ACID
IRV
ALKALINE
ERV
LDH
MBC
SGOT
SGPT URINE
STEROIDS
SPGR
ALDO
PH
L7-OH
PROT
17-KS
GLUC
ACTH
KETONE
ALL ELECTROLYTES
VITS
ALL STEROIDS
A
ALL…† (source)
- And life without enzymes?† (source)
- It's a controlled belch, with a hypergolic effect from an enzyme secreted between the first and second rows of teeth.† (source)
- He had attempted to describe his experiment to me in detail—it had to do with amniotic fluid and the fetus of a rabbit, including weird stuff about enzymes and ion transference—but he had given up on me with an understanding laugh when, having taken me beyond my depth, he saw my look of pain and boredom.† (source)
- Although he had told me in large (though generally impenetrable) detail about the technical nature of his research (enzymes, ion transference, permeable membranes, etc., also the fetus of that miserable rabbit), he had never divulged to me—nor had I out of reticence asked—anything concerning the ultimate justification for this complex and, beyond doubt, profoundly challenging biological enterprise.† (source)
- If it was an enzymatic block of some kind—like arsenic or strychnine—we'd expect fifteen or thirty seconds, perhaps longer.† (source)
- There ensued certain descriptions which I don't command the physical chemistry to repeat, the kinesis of enzymes and so forth.† (source)
- Or maybe it's a chemical principle, an enzyme.† (source)
- But what about Bordet's contention that it's an enzyme?† (source)
- Back in 1881 he was confirming Pasteur's results in chicken cholera immunity and, for relief and pastime, trying to separate an enzyme from yeast.† (source)
- He learned the involved mysteries of freezing-point determinations, osmotic pressure determinations, and tried to apply Northrop's generalizations on enzymes to the study of phage.† (source)
- …as "the boy chemist," speaking of "this gaudy Institute" and "our trusting new lil brother, Arrowsmith") debating with a slight thin-bearded man—Dr. William T. Smith, assistant in bio-chemistry—the possibility of increasing the effects of all enzymes by doses of X-rays, as he heard one associate-member vituperate another for his notions of cell-chemistry and denounce Ehrlich as "the Edison of medical science," Martin perceived new avenues of exciting research; he stood on a mountain,…† (source)
-
Because it's there, the true key—the right enzyme—can't even enter the lock.
(source)
enzyme = complex protein that cause a chemical reaction
- His article attacks Tanida's theory of enzyme fusion— (source)
-
I call it competitive inhibition of enzymes.
(source)
enzymes = complex proteins that cause chemical reactions
- And, of course, newly produced amino acids compete with the normal enzymes causing brain damage. (source)
-
Think of the enzyme produced by the defective gene as a wrong key which fits into the chemical lock of the central nervous system—but won't turn.
(source)
enzyme = a protein that causes a chemical reaction
-
But Tanida himself first propounded the theory of blocking the maverick enzyme through combination, and now he points out that—
(source)
enzyme = complex protein that cause a chemical reaction
- —the concept of changing the chemical structure of the enzyme blocking the step in the metabolic pathway. (source)
-
It is my own feeling that the most successful line of research will be that taken by the men studying enzyme imbalances.
(source)
enzyme = any complex protein that causes a chemical reaction
-
He explained the enzyme-block theory and went on to describe my physical condition before and after surgery.
(source)
enzyme = complex protein that cause a chemical reaction
-
Then Strauss said that the project had as much to do with his techniques in psychosurgery and enzyme-injection patterns, as with Nemur's theories, and that someday thousands of neurosurgeons all over the world would be using his methods, but at this point Nemur reminded him that those new techniques would never have come about if not for his original theory.
(source)
enzyme = complex proteins that cause chemical reactions
-
We don't know exactly what causes the type of phenylketonuria that Charlie was suffering from as a child—some unusual biochemical or genetic situation, possibly ionizing radiation or natural radiation or even a virus attack on the fetus—whatever it was resulted in a defective gene which produces a, shall we say, 'maverick enzyme' that creates defective biochemical reactions.
(source)
enzyme = complex protein that causes a chemical reaction
-
Many researchers have been able to reverse the process through injections of chemicals which combine with the defective enzymes, changing the molecular shape of the interfering key, as it were.
(source)
enzymes = complex proteins that cause chemical reactions
▲ show less (of above)